• Creator: guest181
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: ATCGTTAGGGCGACCCTGAGCGGGGGTCGA
• Function:

  band pass(numbers('epe') if numbers('xry') if numbers('yxr') > numbers('epe') else 10 *(numbers('epe')) > tan(numbers('epe') if numbers('yxr') > 10 *(numbers('epe')) else numbers('xry')) else 10 *(numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.