• Creator: guest185
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: AGGATTGCGGCCACAGCCCGTCTCGACCCG
• Function:

  tan(gradient[0](numbers('yyx') if gradient[2](numbers('yyx')) if numbers('ryy') > numbers('yyx') else numbers('rep') > numbers('ryy') else gradient[2](numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.