• Creator: global
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: GGTACATAGCGGACTTATACGGATTTTTGT
• Function:

  gradient[2](exp(2 *(numbers("yxx")), numbers("yxx")) if 2 *(numbers("yxx")) > numbers('yxy') else numbers("yxx")) if exp(2 *(numbers("yxx")), numbers("yxx")) > 2 *(numbers("yxx")) else numbers("yxx") if 2 *(numbers("yxx")) > numbers('yxy') else exp(2 *(numbers("yxx")), numbers("yxx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.