• Creator: guest200
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: AGATGTCGGATTCTAAAGTTCCTGCTCCCC
• Function:

  sin(max(numbers("xyx"), numbers('rep')) if numbers("xyx") > exp(gradient[0](max(numbers("xyx"), numbers('rep'))), max(numbers("xyx"), numbers('rep'))) else gradient[0](max(numbers("xyx"), numbers('rep'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.