• Creator: guest200
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: GGGGTGACCACAAGGGTGCTCAGAATGCTG
• Function:

  tan(numbers('epe')) if 10 *(gradient[2](tan(numbers('epe')))) if tan(numbers('epe')) > numbers('epe') else gradient[2](tan(numbers('epe'))) > gradient[2](tan(numbers('epe'))) else 10 *(gradient[2](tan(numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.