• Creator: guest200
• Population: 0
• Generation: 11
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CATCCCTACATGACTCCCCGCAACGACTGG
• Function:

  minus(product(numbers('yyx') if numbers('xry') > sqrt(2 *(numbers('yyx'))) else 2 *(numbers('yyx')), sqrt(2 *(numbers('yyx')))), numbers('yyx') if sqrt(2 *(numbers('yyx'))) > numbers('xry') else 2 *(numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.