• Creator: guest202
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TGATCAATTACGCCCGCGTAATCGTGTAGA
• Function:

  100 *(product(numbers('yxy'), numbers("xxx"))) if product(numbers('yxy'), numbers("xxx")) > gradient[0](100 *(product(numbers('yxy'), numbers("xxx")))) else gradient[0](100 *(product(numbers('yxy'), numbers("xxx")))) if product(numbers('yxy'), numbers("xxx")) > numbers('yxy') else 100 *(product(numbers('yxy'), numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.