• Creator: guest247
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: CTGAGGAGTACTCGTGTATGATGGTGAGAC
• Function:

  mean(tan(gradient[1](2 *(log(numbers("per"), numbers("xxr"))))), gradient[1](2 *(log(numbers("per"), numbers("xxr")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.