• Creator: guest280
• Population: 0
• Generation: 1
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: AGTCGTTACATTCAAAATGCTCGCAGTATT
• Function:

  gradient[1](log(numbers("yxx") if sum(numbers("yxx"), numbers('xyy')) > gradient[0](sum(numbers("yxx"), numbers('xyy'))) else numbers('xyy'), gradient[0](sum(numbers("yxx"), numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.