• Creator: guest280
• Population: 0
• Generation: 3
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: AGTCGCCGGGCCACGTCAGATGGAGGTATT
• Function:

  gradient[1](round(exp(numbers("yxx") if numbers("yyy") > numbers("xxr") else 100 *(numbers("yyy")), 100 *(numbers("yyy"))), numbers("yxx") if numbers("xxr") > numbers("yyy") else 100 *(numbers("yyy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.