• Creator: guest49
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: GCGGACGTCACCACCGCGCAGGATGGGCGA
• Function:

  numbers('yxy') if 10 *(numbers('yxy')) > numbers("xyx") if numbers('yxy') > 10 *(10 *(numbers('yxy'))) else 10 *(numbers('yxy')) else 10 *(10 *(numbers('yxy'))) if 10 *(numbers('yxy')) > 10 *(numbers('yxy')) if numbers('yxy') > numbers("xyx") else 10 *(10 *(numbers('yxy'))) else 10 *(10 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.