• Creator: guest49
• Population: 0
• Generation: 2
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CCGCTCTGCGATACTACTCTTCAGCTCGGT
• Function:

  divide(min(numbers('xyy') if 2 *(numbers('xyy')) if numbers('rrr') > numbers('xyy') else numbers("xyx") > numbers('rrr') else 2 *(numbers('xyy')), numbers("xyx") if numbers('rrr') > numbers('xyy') else 2 *(numbers('xyy'))), numbers('rrr') if numbers('rrr') if 2 *(numbers('xyy')) > numbers('xyy') else numbers("xyx") > numbers('xyy') else 2 *(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.