• Creator: guest744
• Population: 0
• Generation: 1
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 09/26/2019
• Genome: TAACGGACCAGACGAGGCACAAGGCCCTGA
• Function:

  10 *(sin(mod(numbers('xry'), numbers("yyy")))) if mod(numbers('xry'), numbers("yyy")) > sin(mod(numbers('xry'), numbers("yyy"))) else exp(10 *(sin(mod(numbers('xry'), numbers("yyy")))), sin(mod(numbers('xry'), numbers("yyy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.