• Creator: Jade
• Population: 0
• Generation: 1
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 12/05/2019
• Genome: TAGACTATACCAGGAACGACTCCCTCTTAATGC
• Function:

  numbers('xyy') if numbers('xyy') > 100 *(numbers('xyy')) else numbers('yyx') if 2 *(logn(product(numbers('yyx') if numbers('xyy') > 100 *(numbers('xyy')) else numbers('xyy'), 100 *(numbers('xyy'))))) > logn(product(numbers('xyy') if 100 *(numbers('xyy')) > numbers('yyx') else numbers('xyy'), 100 *(numbers('xyy')))) else product(numbers('yyx') if numbers('xyy') > 100 *(numbers('xyy')) else numbers('xyy'), 100 *(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.