• Creator: Jade
• Population: 0
• Generation: 3
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 12/05/2019
• Genome: TGAAGATCAAAGACCTCTGAGTCTATAGAG
• Function:

  10 *(numbers('xyy')) if 10 *(numbers('xyy')) if numbers("xyx") > numbers('xyy') else invert(10 *(numbers('xyy'))) > invert(10 *(numbers('xyy'))) else sin(numbers('xyy') if 10 *(numbers('xyy')) > numbers("xyx") else invert(10 *(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.