• Creator: Jade
• Population: 0
• Generation: 7
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 12/06/2019
• Genome: TTCTCTTATACCCTTGATTAGTGTCCCGAC
• Function:

  round(numbers("yxx"), numbers("xyx")) if round(numbers("yxx"), numbers("xyx")) if numbers("xyx") > numbers("yxx") else 10 *(round(numbers("yxx"), numbers("xyx"))) > round(numbers("yxx"), numbers("xyx")) if 10 *(round(numbers("yxx"), numbers("xyx"))) > numbers("xyx") else numbers("yxx") if numbers("yxx") > 10 *(round(numbers("yxx"), numbers("xyx"))) else round(numbers("yxx"), numbers("xyx")) else 10 *(round(numbers("yxx"), numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.