• Creator: Jade
• Population: 0
• Generation: 8
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 12/06/2019
• Genome: TACTCTTATACCCTTGGTTATTGTCCAGAC
• Function:

  round(numbers('ryy'), numbers("yxx")) if numbers("yxx") if 10 *(round(numbers('ryy'), numbers("yxx"))) > round(numbers('ryy'), numbers("yxx")) else numbers('ryy') > numbers('ryy') if numbers("yxx") > 10 *(round(numbers('ryy'), numbers("yxx"))) else round(numbers('ryy'), numbers("yxx")) if round(numbers('ryy'), numbers("yxx")) > 10 *(round(numbers('ryy'), numbers("yxx"))) else numbers('ryy') else 10 *(round(numbers('ryy'), numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.