• Creator: Jade
• Population: 0
• Generation: 23
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 12/06/2019
• Genome: ATTAGGACGGCGGGAACGAATGTCGCACCCTAA
• Function:

  gradient[0](tan(100 *(numbers("yxx") if numbers('rep') if 100 *(numbers("yxx")) > numbers("yxx") else numbers("yyy") > numbers('rep') else 100 *(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.