• Creator: Jade
• Population: 0
• Generation: 30
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: GTTCTGACAACAAGGTCTCGCGGACCATTC
• Function:

  tan(numbers('xyy')) if gradient[2](gradient[2](tan(numbers('xyy')))) > gradient[2](tan(numbers('xyy'))) else mean(gradient[2](gradient[2](tan(numbers('xyy')))), gradient[2](tan(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.