• Creator: Jade
• Population: 0
• Generation: 32
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 12/06/2019
• Genome: TATCACCAAGAGACAAGGTCGTAGACTGGAAATGCG
• Function:

  numbers("xyx") if tan(numbers('yxy')) > numbers('yxy') else gradient[2](tan(numbers('yxy'))) if sum(sum(numbers('yxy') if numbers("xyx") > gradient[2](tan(numbers('yxy'))) else tan(numbers('yxy')), gradient[2](tan(numbers('yxy')))), numbers("xyx") if gradient[2](tan(numbers('yxy'))) > tan(numbers('yxy')) else numbers('yxy')) > gradient[2](tan(numbers('yxy'))) else sum(gradient[2](tan(numbers('yxy'))) if numbers('yxy') > numbers("xyx") else tan(numbers('yxy')), gradient[2](tan(numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.