• Creator: guest15120
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 12/12/2024
• Genome: ATCCCGCACGATACGACCAATCCATCAAGG
• Function:

  band pass(divide(sum(numbers("yyy") if numbers("yxx") > numbers('yyx') else 100 *(numbers('yyx')), 100 *(numbers('yyx'))), numbers("yxx") if numbers('yyx') > numbers("yyy") else 100 *(numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.