• Creator: guest15120
• Population: 0
• Generation: 3
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 12/12/2024
• Genome: GATGGCTTTGGTACGAGCCGCAGTTGCTCGAGT
• Function:

  100 *(cos(numbers('xry'))) if numbers('xry') if numbers('ryy') > cos(numbers('xry')) else 100 *(cos(numbers('xry'))) > numbers('xry') if numbers('ryy') > cos(numbers('xry')) else 100 *(cos(numbers('xry'))) if numbers('xry') > cos(numbers('xry')) else 100 *(cos(numbers('xry'))) else numbers('ryy') if cos(numbers('xry')) > numbers('xry') else 100 *(cos(numbers('xry'))) if cos(numbers('xry')) > 100 *(cos(numbers('xry'))) if cos(numbers('xry')) > numbers('ryy') else numbers('xry') if cos(numbers('xry')) > 100 *(cos(numbers('xry'))) else numbers('xry') else 100 *(cos(numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.