• Creator: Jade
• Population: 0
• Generation: 53
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 12/06/2019
• Genome: TCGTCGACGAGCAATCTTTTTGTATTCGGACAT
• Function:

  noise(round(numbers('rrr'), numbers("per"))) if noise(round(numbers('rrr'), numbers("per"))) if cos(noise(round(numbers('rrr'), numbers("per")))) > round(numbers('rrr'), numbers("per")) else 100 *(cos(noise(round(numbers('rrr'), numbers("per"))))) > cos(noise(round(numbers('rrr'), numbers("per")))) else 100 *(cos(noise(round(numbers('rrr'), numbers("per")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.