header

genetic-algorithms.com

 

Inspect Jade_0_54_15

Parents

Mother

Image 01

Jade_0_53_11

Genome: CCATAGGTAGCTATTTCGTGATTATGACCGTAG

Father

Image 01

Jade_0_53_8

Genome: GAACACTTCCAACCCAATGGGTCGCCATTCTTCGAG

Jade_0_54_15

Image 01

  • Creator: Jade
  • Population: 0
  • Generation: 54
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 12/06/2019
  • Genome: AAACCATAGTTAGCAATTTCGTGATTCTCACCGTAG
  • Function:

    abs(product(numbers('yxy') if numbers('yxy') if numbers('rep') > gradient[0](numbers('yxy')) else numbers("xxr") > gradient[0](numbers('yxy')) else numbers("xxr") if numbers('rep') if numbers('yxy') > gradient[0](numbers('yxy')) else numbers("xxr") > gradient[0](numbers('yxy')) else numbers('yxy'), numbers('rep') if numbers("xxr") > numbers('yxy') else gradient[0](numbers('yxy')) if gradient[0](numbers('yxy')) > numbers('yxy') else numbers("xxr")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Jade_0_54_15 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!