• Creator: guest16600
• Population: 0
• Generation: 1
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 06/16/2025
• Genome: CTACTAAGCATAACATGCCTTAAACCCGCC
• Function:

  max(max(cos(logn(gradient[2](numbers('xry')))), logn(gradient[2](numbers('xry')))), cos(logn(gradient[2](numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.