• Creator: guest1157
• Population: 1
• Generation: 5
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/16/2020
• Genome: ACTATGCCTGAAAAGACTGTAATGAATGTACGT
• Function:

  2 *(sqrt(divide(numbers("per") if numbers('epe') > invert(2 *(numbers("per"))) else 2 *(numbers("per")), invert(2 *(numbers("per"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.