• Creator: guest1157
• Population: 1
• Generation: 7
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 02/16/2020
• Genome: CGTTACAGGTGAACGTAAGTGTCCATCGGG
• Function:

  log(numbers("xxx") if 100 *(numbers("xxx")) > numbers('yyx') else numbers('epe') if tan(numbers('yyx') if 100 *(numbers("xxx")) > numbers("xxx") else numbers('epe')) > numbers("xxx") else 100 *(numbers("xxx")), tan(numbers('yyx') if numbers("xxx") > numbers('epe') else 100 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.