• Creator: guest63
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: GAGAGCTCGATTAAAGGGCAACCACGACTC
• Function:

  cos(abs(numbers('yxr')) if numbers("xxx") > gradient[0](abs(numbers('yxr'))) else numbers('yxr')) if abs(numbers('yxr')) > numbers("xxx") if abs(numbers('yxr')) > numbers('yxr') else gradient[0](abs(numbers('yxr'))) else gradient[0](abs(numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.