• Creator: guest17309
• Population: 0
• Generation: 0
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 09/09/2025
• Genome: GTAACCAAAATGAAGATAGGAGGCGTCTGA
• Function:

  abs(sqrt(invert(numbers("per")))) if sqrt(invert(numbers("per"))) > invert(numbers("per")) else 10 *(abs(sqrt(invert(numbers("per")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.