• Creator: guest1202
• Population: 0
• Generation: 0
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 02/29/2020
• Genome: GACACCATTCTGAGGAGGCATGAACGCAAA
• Function:

  tan(numbers('yxr')) if mean(tan(numbers('yxr')), numbers('yxr')) > gradient[0](mean(tan(numbers('yxr')), numbers('yxr'))) else 10 *(gradient[0](mean(tan(numbers('yxr')), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.