• Creator: guest18663
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 03/07/2026
• Genome: TTGAGACTATGTACTGTGACGAGTCTGGTA
• Function:

  sin(max(numbers('yxy') if 2 *(numbers('epe')) > numbers('ryy') else numbers('epe'), 2 *(numbers('epe')))) if 2 *(numbers('epe')) > numbers('ryy') if numbers('yxy') > 2 *(numbers('epe')) else numbers('epe') else max(2 *(numbers('epe')) if numbers('ryy') > numbers('yxy') else numbers('epe'), 2 *(numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.