• Creator: sina12345
• Population: 0
• Generation: 5
• Total Fitness: 19
• No. Votes: 2
• Avg. Fitness 9.5
• Created: 05/19/2019
• Genome: ACATACCCCAGTACGAGTTACCAACAACAGTAG
• Function:

  gradient[2](product(gradient[1](100 *(gradient[1](numbers("xxy")))), 100 *(gradient[1](numbers("xxy")))) if gradient[1](100 *(gradient[1](numbers("xxy")))) > 100 *(gradient[1](numbers("xxy"))) else gradient[1](numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.