• Creator: guest1650
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/16/2020
• Genome: GCAAGCCCCTGTAGCACCACTCCTTACAGTGGG
• Function:

  product(numbers('xyy') if cos(10 *(numbers('xyy'))) > numbers('xyy') else 10 *(numbers('xyy')), cos(10 *(numbers('xyy')))) if cos(10 *(numbers('xyy'))) > numbers('xyy') if numbers('xyy') > 10 *(numbers('xyy')) else cos(10 *(numbers('xyy'))) else cos(product(numbers('xyy') if numbers('xyy') > cos(10 *(numbers('xyy'))) else 10 *(numbers('xyy')), cos(10 *(numbers('xyy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.