• Creator: sina12345
• Population: 1
• Generation: 9
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: AAGGGGTCCAAGAGTTCTCACTACAATGAT
• Function:

  invert(numbers('xyy') if numbers("xxy") if gradient[1](numbers('xyy')) > numbers('xyy') else invert(gradient[1](numbers('xyy'))) > invert(gradient[1](numbers('xyy'))) else gradient[1](numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.