• Creator: guest73
• Population: 0
• Generation: 4
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CCGTATGGACTCACAAGCAAGTCGCGCCTGTTC
• Function:

  divide(cos(numbers("xyx")) if gradient[2](cos(numbers("xyx"))) > min(gradient[2](cos(numbers("xyx"))), cos(numbers("xyx"))) else cos(numbers("xyx")) if min(gradient[2](cos(numbers("xyx"))), cos(numbers("xyx"))) > numbers("xyx") else gradient[2](cos(numbers("xyx"))), cos(numbers("xyx")) if min(gradient[2](cos(numbers("xyx"))), cos(numbers("xyx"))) > numbers("xyx") else gradient[2](cos(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.