• Creator: guest73
• Population: 0
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: CGATTGTAAGTACCCACGTAGGGCGGCTCGAGA
• Function:

  mod(product(100 *(numbers("xyx")), numbers("xyx")) if 100 *(numbers("xyx")) > numbers('xry') else numbers("xyx") if product(100 *(numbers("xyx")), numbers("xyx")) > 100 *(numbers("xyx")) else 100 *(numbers("xyx")) if product(100 *(numbers("xyx")), numbers("xyx")) > 100 *(numbers("xyx")) if numbers("xyx") > numbers('xry') else product(100 *(numbers("xyx")), numbers("xyx")) else numbers("xyx"), numbers("xyx") if product(100 *(numbers("xyx")), numbers("xyx")) > numbers('xry') if 100 *(numbers("xyx")) > product(100 *(numbers("xyx")), numbers("xyx")) else numbers("xyx") else 100 *(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.