• Creator: sina12345
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 14
• No. Votes: 2
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: TGATTTTAAAGTAGACCTCGGCCGAGCCGG
• Function:

  numbers('xyy') if gradient[1](sin(numbers('xyy'))) > numbers('yxr') else sin(numbers('xyy')) if sin(numbers('xyy')) > sin(numbers('xyy')) if numbers('xyy') > gradient[1](sin(numbers('xyy'))) else gradient[1](sin(numbers('xyy'))) if sin(numbers('xyy')) > numbers('yxr') else numbers('xyy') else gradient[1](sin(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.