• Creator: guest75
• Population: 0 (Global)
• Generation: 1
• Total Fitness: 10
• No. Votes: 2
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: ACATCGACTATGCCCCGGGCCTTTCCGAGCCGG
• Function:

  gradient[2](sqrt(product(exp(numbers('yyx'), numbers('rrr')), numbers('yyx'))) if exp(numbers('yyx'), numbers('rrr')) > product(exp(numbers('yyx'), numbers('rrr')), numbers('yyx')) else 2 *(sqrt(product(exp(numbers('yyx'), numbers('rrr')), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.