• Creator: guest79
• Population: 0
• Generation: 4
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CGAAGCGCCGGTACTTCGACTCATACTGCC
• Function:

  mod(cos(numbers('yxy') if 2 *(numbers('yxy')) > numbers("yxx") if numbers('yxy') > numbers('xyy') else 2 *(numbers('yxy')) else numbers('xyy')), numbers('xyy') if numbers("yxx") if numbers('xyy') > 2 *(numbers('yxy')) else numbers('yxy') > numbers('yxy') else 2 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.