• Creator: guest90
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TCCAATTCAACAAAAGATCGTGGTAGATCA
• Function:

  gradient[2](abs(numbers("yxx"))) if abs(numbers("yxx")) > numbers("yxx") if numbers('ryy') > gradient[2](abs(numbers("yxx"))) else abs(numbers("yxx")) else noise(numbers('ryy') if abs(numbers("yxx")) > numbers("yxx") else gradient[2](abs(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.