• Creator: guest98
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GGAATTTAGACCAAGCGCTAGAGCGCCACTATA
• Function:

  gradient[0](round(numbers("xyx"), numbers('xry')) if numbers("xyx") > invert(round(numbers("xyx"), numbers('xry'))) else 10 *(invert(round(numbers("xyx"), numbers('xry'))))) if numbers("xyx") if invert(round(numbers("xyx"), numbers('xry'))) > 10 *(invert(round(numbers("xyx"), numbers('xry')))) else round(numbers("xyx"), numbers('xry')) > invert(round(numbers("xyx"), numbers('xry'))) else 10 *(invert(round(numbers("xyx"), numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.