• Creator: guest105
• Population: 0
• Generation: 5
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GACTGAACGCGACCATGGCGTAGCGCGCAT
• Function:

  mod(product(numbers('yxr'), numbers('ryy')), numbers('yxr')) if product(numbers('yxr'), numbers('ryy')) > product(numbers('yxr'), numbers('ryy')) if mod(product(numbers('yxr'), numbers('ryy')), numbers('yxr')) > 100 *(mod(product(numbers('yxr'), numbers('ryy')), numbers('yxr'))) else numbers('yxr') else 100 *(mod(product(numbers('yxr'), numbers('ryy')), numbers('yxr')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.