• Creator: guest3559
• Population: 0
• Generation: 1
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 01/16/2021
• Genome: CGTTCGGTGAGAACCCAGCAGTACTCTCTA
• Function:

  log(numbers("xyx") if sin(10 *(numbers("xyx"))) if numbers("xyx") > 10 *(numbers("xyx")) else numbers("xyx") > 10 *(numbers("xyx")) else sin(10 *(numbers("xyx"))), numbers("xyx") if numbers("xyx") > 10 *(numbers("xyx")) else sin(10 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.