• Creator: guest3962
• Population: 0
• Generation: 3
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 04/10/2021
• Genome: GTTGAGGGAACAACGGCGCCTGGACTGACC
• Function:

  100 *(numbers('yxy')) if 100 *(numbers('yxy')) if numbers('yxy') > numbers('xyy') else gradient[2](100 *(numbers('yxy'))) > numbers('yxy') if 100 *(numbers('yxy')) > gradient[2](100 *(numbers('yxy'))) else numbers('yxy') if numbers('xyy') > 100 *(numbers('yxy')) else gradient[2](100 *(numbers('yxy'))) else gradient[2](100 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.