• Creator: tquinlan
• Population: 0
• Generation: 6
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: ATGAATGCGTGAACTAAGGCCAGTAGCGTA
• Function:

  sqrt(noise(numbers("xyx") if numbers('yyx') > numbers('ryy') if 2 *(numbers("xyx")) > numbers('yyx') else numbers("xyx") else 2 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.