• Creator: guest3961
• Population: 0
• Generation: 3
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 04/10/2021
• Genome: TAAAGGACGACGGCCCCAGAGGAGTAATGAATA
• Function:

  100 *(numbers("xxx") if product(numbers("xyx"), numbers("xyx")) > numbers("xyx") else numbers("xyx")) if 100 *(100 *(numbers("xyx") if product(numbers("xyx"), numbers("xyx")) > numbers("xyx") else numbers("xxx"))) > tan(100 *(100 *(numbers("xyx") if product(numbers("xyx"), numbers("xyx")) > numbers("xyx") else numbers("xxx")))) else product(numbers("xyx"), numbers("xyx")) if numbers("xyx") > numbers("xxx") else numbers("xyx")

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.