• Creator: robertjamesd220
• Population: 0
• Generation: 2
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/18/2021
• Genome: TTATGAAGAAAGACGGCTGCCAAGTTACAA
• Function:

  invert(100 *(numbers('xyy'))) if 100 *(numbers('xyy')) > sin(invert(100 *(numbers('xyy')))) else numbers('xyy') if 100 *(numbers('xyy')) > invert(100 *(numbers('xyy'))) else sin(invert(100 *(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.