• Creator: robertjamesd220
• Population: 0
• Generation: 7
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/18/2021
• Genome: TGAGAGTCAACCCTTACGGATGAAATTTCTCGC
• Function:

  10 *(round(100 *(numbers("yxx")), numbers("yxx"))) if numbers("yxx") if round(100 *(numbers("yxx")), numbers("yxx")) > 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) else 100 *(numbers("yxx")) > numbers("yxx") if round(100 *(numbers("yxx")), numbers("yxx")) > 100 *(numbers("yxx")) else 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) if 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) > 100 *(numbers("yxx")) else round(100 *(numbers("yxx")), numbers("yxx")) else round(100 *(numbers("yxx")), numbers("yxx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.