• Creator: robertjamesd220
• Population: 0
• Generation: 8
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/18/2021
• Genome: GAGTCAACCCTTACCAGATCGATCTCTGGC
• Function:

  numbers("xxr") if round(10 *(numbers("xxr")), numbers("xxr")) > 10 *(round(10 *(numbers("xxr")), numbers("xxr"))) else 10 *(numbers("xxr")) if 10 *(numbers("xxr")) > 10 *(round(10 *(numbers("xxr")), numbers("xxr"))) else round(10 *(numbers("xxr")), numbers("xxr"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.