• Creator: robertjamesd220
• Population: 3
• Generation: 20
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2021
• Genome: CGTCACGCACGAACTCTGGCGCGGGTCCAACACTGT
• Function:

  log(sum(2 *(mean(numbers('yxy'), numbers('yxr'))) if mod(2 *(mean(numbers('yxy'), numbers('yxr'))), mean(numbers('yxy'), numbers('yxr'))) > mean(numbers('yxy'), numbers('yxr')) else numbers('yxy'), mod(2 *(mean(numbers('yxy'), numbers('yxr'))), mean(numbers('yxy'), numbers('yxr')))), mod(2 *(mean(numbers('yxy'), numbers('yxr'))), mean(numbers('yxy'), numbers('yxr'))) if numbers('yxy') > mean(numbers('yxy'), numbers('yxr')) else 2 *(mean(numbers('yxy'), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.